View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8113_low_14 (Length: 230)
Name: NF8113_low_14
Description: NF8113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8113_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 361809 - 361612
Alignment:
| Q |
18 |
actgctatggttggtgctggtgtcctagggttaccatttgctttatcccagcttggatggtatttatatcttaattcattcaatttcatcacttcaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361809 |
actgctatggttggtgctggtgtcctagggttaccatttgctttatcccagcttggatggtatttatatcttaattcattcaatttcatcacttcaaact |
361710 |
T |
|
| Q |
118 |
cttcattaccactatctaggtcacttactcgacaccaatgaaaacacatcaccactggtaacaaatcgagaacatgagttaaggatgtaatcacgtgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361709 |
cttcattaccactatctaggtcacttactcgacaccaatgaaaacacatcaccactggtaacaaatcgagaacatgagttaaggatgtaatcacgtgt |
361612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University