View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8113_low_4 (Length: 471)
Name: NF8113_low_4
Description: NF8113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8113_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 268
Target Start/End: Complemental strand, 12953651 - 12953393
Alignment:
| Q |
10 |
tgagaagaagaaaaagaaagatgattttgttgttgaggattatagttctgtttctgttgttgaggaatttgagagtgctgttagtgttcctaatactact |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12953651 |
tgagaagaagaaaaagaaagatgattttgttgttgaggattgtagttctgtttctgttgttgaggaatttgagagtgctgttagtgttactaatactact |
12953552 |
T |
 |
| Q |
110 |
gctggaaatgatattgatcagtcgccggagagctgtaatgttagggttttggttgattctgatgcttcaccggaggtggcggttgtttcgcaatcaagtg |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12953551 |
gctggaaatgatattgatcggtcgccggagagctgtaatgttagggttttggttgattctgatgcttcaccggaggtggcggttgtttcgcaatcaagtg |
12953452 |
T |
 |
| Q |
210 |
ttgtgtctgatgggtgttttgataagtttagtattgatagtgggaatcagaggaagagg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12953451 |
ttgtgtctgatgggtgttttgataagtttagtattgatagtgggaatcagaggaagagg |
12953393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 314 - 452
Target Start/End: Complemental strand, 12953350 - 12953212
Alignment:
| Q |
314 |
aagcaggagaataatgggggaggatctgaatcagggagagtgaaggattatgtgatggagtggattgggagtgagataaagaaagagagacctaagagta |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12953350 |
aagcaggagaataatgggggaggatctgaatcagggagagtgaaggattatgtgatggagtggattgggagtgagataaagaaagagagacctaagagta |
12953251 |
T |
 |
| Q |
414 |
gtgagtgggttggttctggttcttcaatttgttccggtg |
452 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12953250 |
gtgagtgggttggttctggttcttcgatttgttccggtg |
12953212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University