View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8114_high_2 (Length: 440)
Name: NF8114_high_2
Description: NF8114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8114_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 20 - 428
Target Start/End: Complemental strand, 45564341 - 45563933
Alignment:
| Q |
20 |
gtctctttgtcggaattgtgggaatgacttttgtacttcaggtaaataggcatatcattcattattttatttattttcttagttggcaacattttgaatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564341 |
gtctctttgtcggaattgtgggaatgacttttgtacttcaggtaaataggcatatcattcattattttatttattttcttagttggcaacattttgaatg |
45564242 |
T |
 |
| Q |
120 |
catctatgtctctatgttaaattgatagataatcatcatcgagttccttgggaagtttgcaacaacagtgaggctgaattggcagcagtggcttgcttgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45564241 |
catctatgtctctatgttaaattgatagataatcatcatcgagttccttgggaagtttgcaacaacagtgaagctgaattggcagcagtggcttgcttgt |
45564142 |
T |
 |
| Q |
220 |
tttggtattgggctggtcaggttagtgcactcaactgtagaaggttgattatccatattgataatcattttacaatcacaaaatgatagtcattcttccc |
319 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564141 |
gtttgtattgggctggtcaggttagtgcactcaactgtagaaggttgattatccatattgataatcattttacaatcacaaaatgatagtcattcttccc |
45564042 |
T |
 |
| Q |
320 |
tctcaatatatattagcttcatatgatagtactaaccagctgatttttccttccaacagctggccacttgcggtaattggaaaattaattccagttccca |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45564041 |
tctcaatatatattagcttcatatgatagtactaaccagctgatttttccttccaacagctggccacttgcggtaattggaaaattaattccagttccca |
45563942 |
T |
 |
| Q |
420 |
aaacaccaa |
428 |
Q |
| |
|
||||||||| |
|
|
| T |
45563941 |
aaacaccaa |
45563933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University