View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8114_low_7 (Length: 229)
Name: NF8114_low_7
Description: NF8114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8114_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 71 - 214
Target Start/End: Complemental strand, 34725732 - 34725589
Alignment:
| Q |
71 |
agtactgtcactatgctttctcatgactccaatttccattttacatccaaaatccttgcaaccaagagtgttaatccaggtttgccacatttttgtgctg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34725732 |
agtactgtcactatgctttctcatgactccaatttccattttacatccaaaatccttgcaaccaagagtgttaatccaggtttgccacatttttgtgctg |
34725633 |
T |
 |
| Q |
171 |
annnnnnnnaactcttgcaggtgtagaagatttcatgaactttt |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34725632 |
attttttttaactcttgcaggtgtagaagatttcatgaactttt |
34725589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 71 - 152
Target Start/End: Complemental strand, 38610386 - 38610305
Alignment:
| Q |
71 |
agtactgtcactatgctttctcatgactccaatttccattttacatccaaaatccttgcaaccaagagtgttaatccaggtt |
152 |
Q |
| |
|
||||||||||||||||||||| ||| | |||| ||||||||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
38610386 |
agtactgtcactatgctttctgttgatttcaatgtccattttacatccaaagtccttgcaaccaagagtatcaatccaggtt |
38610305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 71 - 152
Target Start/End: Complemental strand, 38795171 - 38795090
Alignment:
| Q |
71 |
agtactgtcactatgctttctcatgactccaatttccattttacatccaaaatccttgcaaccaagagtgttaatccaggtt |
152 |
Q |
| |
|
||||||||||||||||||||| ||| | |||| ||||||||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
38795171 |
agtactgtcactatgctttctgttgatttcaatgtccattttacatccaaagtccttgcaaccaagagtatcaatccaggtt |
38795090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 44834819 - 44834868
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaacag |
70 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44834819 |
ttttcccctttatccctcaatttcaacaacaacaacaattccactaacag |
44834868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 34729789 - 34729722
Alignment:
| Q |
72 |
gtactgtcactatgctttctcatgactccaatttccattttacatccaaaatccttgcaaccaagagt |
139 |
Q |
| |
|
|||||||||||||| ||||| |||| |||| | ||||||||||||||||| | ||||||||||||||| |
|
|
| T |
34729789 |
gtactgtcactatgttttctgatgattccattgtccattttacatccaaagttcttgcaaccaagagt |
34729722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 34720487 - 34720424
Alignment:
| Q |
76 |
tgtcactatgctttctcatgactccaatttccattttacatccaaaatccttgcaaccaagagt |
139 |
Q |
| |
|
|||||||||||| ||| |||| ||| || ||||||||||||| ||| |||||| |||||||||| |
|
|
| T |
34720487 |
tgtcactatgctatctgatgattccgatgtccattttacatctaaagtccttgaaaccaagagt |
34720424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 14 - 69
Target Start/End: Complemental strand, 45811239 - 45811184
Alignment:
| Q |
14 |
attatactttttccctttatccctcaatttcaacaacaacaacaattccactaaca |
69 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45811239 |
attatatttttttcctttatccctcaatttcaacaacaacaacaattccactaaca |
45811184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 30478821 - 30478772
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaacag |
70 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30478821 |
ttttcccctttatccctcaatttcaacaacaacaacaattccactaacag |
30478772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 21 - 69
Target Start/End: Original strand, 48013428 - 48013476
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaaca |
69 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48013428 |
ttttcccctttatccctcaatttcaacaacaacaacaattccactaaca |
48013476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 19521853 - 19521804
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaacag |
70 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19521853 |
ttttcccctttatccctcaatttcaacaacaacaacaattccactaacag |
19521804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 25329895 - 25329849
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaa |
67 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25329895 |
ttttcccctttatccctcaatttcaacaacaacaacaattccactaa |
25329849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 69
Target Start/End: Complemental strand, 26688677 - 26688629
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaaca |
69 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26688677 |
ttttcccctttatccgtcaatttcaacaacaacaacaattccactaaca |
26688629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 69
Target Start/End: Complemental strand, 26958408 - 26958360
Alignment:
| Q |
21 |
tttttccctttatccctcaatttcaacaacaacaacaattccactaaca |
69 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26958408 |
ttttcccctttatccgtcaatttcaacaacaacaacaattccactaaca |
26958360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University