View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8115_low_7 (Length: 242)
Name: NF8115_low_7
Description: NF8115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8115_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 5396073 - 5396281
Alignment:
| Q |
20 |
actatgacatgaactttaactagacaacatcccacatcaatagaagctcgcgatgaatgatttgtctataaattttaaattgttcccgtgataaatttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||| |
|
|
| T |
5396073 |
actatgacatgaactttaactagacaacatcccacatcaatagaagctcgcgatgaatgatttgtcgataaatcttaaattgttccggtgataaatttgt |
5396172 |
T |
|
| Q |
120 |
caataattacaatccttaatagacaactagtagcaaattactcatagtctttaagagaactgaatttcataagctaatcaattcatggtgtggtgccaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396173 |
caataattacaatccttaatagacaactagtagcaaattactcatagtctttgagagaactgaatttcataagctaatcaattcatggtgtggtgccaat |
5396272 |
T |
|
| Q |
220 |
aatgtgaga |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
5396273 |
aatgtgaga |
5396281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University