View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8117_low_11 (Length: 318)
Name: NF8117_low_11
Description: NF8117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8117_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 99 - 308
Target Start/End: Complemental strand, 32698747 - 32698538
Alignment:
| Q |
99 |
agaaaacaaaattatgggaaaacggcatggtcgaaattcagattgatatccatccaaatccctcttgttttattatttggatccgcctccttgtgatatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32698747 |
agaaaacaaaattatgggaaaacggcatggtcgaaattcagatcgatatccatccaaatccctcttgttttattatttggatccgcctccttgtgatatg |
32698648 |
T |
 |
| Q |
199 |
cggccgccgccgcaatcgagtaggcctctatcannnnnnnnnnnnnatctccttttcatatcaatccatcgtggtcgttgccgtgcgcttgtgtgcttca |
298 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32698647 |
cggccgccgccgcaatcaagtaggcctctatcattttcgattttttatctccttttcatatcaatccatcgtggtcgttgccgtgcgcttgtgtgcttca |
32698548 |
T |
 |
| Q |
299 |
tgtttctctg |
308 |
Q |
| |
|
|||||||||| |
|
|
| T |
32698547 |
tgtttctctg |
32698538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 99 - 305
Target Start/End: Complemental strand, 5610925 - 5610719
Alignment:
| Q |
99 |
agaaaacaaaattatgggaaaacggcatggtcgaaattcagattgatatccatccaaatccctcttgttttattatttggatccgcctccttgtgatatg |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5610925 |
agaaaacaaaattatggaaaaacggcatggtcgaaattcagatcgatatccatccaaatccctcttgttttattatttggatccgcctccttgtgatatg |
5610826 |
T |
 |
| Q |
199 |
cggccgccgccgcaatcgagtaggcctctatcannnnnnnnnnnnnatctccttttcatatcaatccatcgtggtcgttgccgtgcgcttgtgtgcttca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5610825 |
cggccgccgccgcaatcgagtaggcctctatcattttcgattttttatctccttttcatatcaatccatcgtggtcgttgccgtgcgcttgtgtgcttca |
5610726 |
T |
 |
| Q |
299 |
tgtttct |
305 |
Q |
| |
|
| ||||| |
|
|
| T |
5610725 |
tatttct |
5610719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 116 - 230
Target Start/End: Complemental strand, 30512821 - 30512710
Alignment:
| Q |
116 |
gaaaacggcatggtcgaaattcagattgatatccatccaaatccctcttgttttattatttggatccgcctccttgtgatatgcggccgccgccgcaatc |
215 |
Q |
| |
|
||||||||||||| ||||||||||| || |||||||||||||||||| |||||||||| |||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
30512821 |
gaaaacggcatggctgaaattcagatcgaaatccatccaaatccctctcgttttattatctggatccgcctccttgtgatctgcg---gccgccacaatc |
30512725 |
T |
 |
| Q |
216 |
gagtaggcctctatc |
230 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
30512724 |
gagtatgcctctatc |
30512710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University