View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8117_low_5 (Length: 398)
Name: NF8117_low_5
Description: NF8117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8117_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 163 - 363
Target Start/End: Complemental strand, 22156282 - 22156082
Alignment:
| Q |
163 |
caaaacttttgtttcgtgtagccattttataagataactttctttaccaaaacagttccnnnnnnnnttcttttacataattctagatagtagtaagttc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22156282 |
caaaacttttgtttcgtgtagccattttataagataactttctttaccgaaacagttccaaaaaaaattcttttacataattctagatagtagtaagttc |
22156183 |
T |
|
| Q |
263 |
gtacacgacagtagtgagatgaagtttcgtaattactatcacagcccatgcattcttttacaaaaggtaaaaatttaatttcccataatttgctactagc |
362 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22156182 |
gtacacgacactagtgagatgaagtttcgtaattactatcacagcccatgcattcttttacaaatggtaaaaatttaatttcccataatttgctactagc |
22156083 |
T |
|
| Q |
363 |
g |
363 |
Q |
| |
|
| |
|
|
| T |
22156082 |
g |
22156082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 37 - 116
Target Start/End: Complemental strand, 22156408 - 22156329
Alignment:
| Q |
37 |
attgattctctaatttggcaacaatatgagaataaagcttagcattggtgagtacatgaatgtcgtagatgattataccg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22156408 |
attgattctctaatttggcaacaatatgagaataaagctcagcattggtgagtacatgaatgtcgtagatgattataccg |
22156329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University