View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8119_low_10 (Length: 317)
Name: NF8119_low_10
Description: NF8119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8119_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 22 - 257
Target Start/End: Original strand, 41334770 - 41335008
Alignment:
| Q |
22 |
ccactatagtgtgattctccaccatctccctaaagagcc-atcaaactttattaaagacnnnnnnnnnnnnn--cgctaaaggattgaaacaccatggtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41334770 |
ccactatagtgtgattctccaccatctccctaaagagcccatcaaactttattaaagacaaaaaaaaataaaaacgctaaaggattgaaacaccatggtt |
41334869 |
T |
|
| Q |
119 |
ttctcttctattccatcttatttagatcctctcaactggcagcaagtaagnnnnnnnnnnnnnnnnctttcacaaaagattgaatttatttattcctatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
41334870 |
ttctcttctattccatcttatttagatcctctcaattggcagcaagtaagttttttctttttttttctttcactaaagagtgaatttatttattcctatt |
41334969 |
T |
|
| Q |
219 |
cctttgtaataataatatcttcttgaatatacctgcaga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41334970 |
cctttgtaataataatatcttcttgaatatacttgcaga |
41335008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 23663083 - 23663129
Alignment:
| Q |
33 |
tgattctccaccatctccctaaagagccatc-aaactttattaaaga |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
23663083 |
tgattctccaccatctccctaaagagccatcaaaactttataaaaga |
23663129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University