View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8119_low_17 (Length: 239)
Name: NF8119_low_17
Description: NF8119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8119_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 26794248 - 26794031
Alignment:
| Q |
1 |
ataatgattttttgttcaatttagattcggttttatttgtaatatgagctagcggtgtgttgctcccttcaattcgagaaatatatagtttgttgatcta |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
26794248 |
ataatgattttttgttgaatttagattcggttttatttgtaatatgagctagaggtgtgttgctcc-ttcgattcgagaaatatatagtttgttgatcta |
26794150 |
T |
 |
| Q |
101 |
tatatgtgggggattagatatccctaattattaatttatagctagttgtacatggattattgttgtatatatgtgttggagtacctcttgtactctcttc |
200 |
Q |
| |
|
| |||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26794149 |
t----gtggaggattagacatccctaattattaatttatagctaattgtacatggattattgttgtatatatgtgttggagtatctcttgtactctcttc |
26794054 |
T |
 |
| Q |
201 |
gtattatatgtgagggttgtata |
223 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
26794053 |
gtattatatgtgagtgttgtata |
26794031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University