View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8119_low_8 (Length: 335)
Name: NF8119_low_8
Description: NF8119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8119_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 34353931 - 34353621
Alignment:
| Q |
1 |
aaaaggtccgccggagaaactctctgatgcagcgcgggatggtgaaggaaatgaaaagaaatcgtggtaatcggcggtgactcttcttttcatacgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353931 |
aaaaggtccgccggagaaactctctgatgcagcgagggatggtgaaggaaatgaaaagaaatcgtggtaatcggcggtgactcttcttttcatacgtttt |
34353832 |
T |
|
| Q |
101 |
aaggatttgcctccgctaacgaccatgatagaagaggttacaggcgcgtggtccagtttcggtggcgcgtgaggtgaggtgagatctcggtggagagttg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34353831 |
aaggatttgccgccgctaacgaccatgatagaagaggttacaggcgcgtggtccagtttcggtggcgcgtgagg-----tgagatctcggtggagagttg |
34353737 |
T |
|
| Q |
201 |
tggatctgaaagggagggaagagaggattagggtttggttattgtgtttgatggttgtcgttggattaatctgggatgaacattttatatatagaagaat |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353736 |
tggatctgaaagagagggaagagaggattagggtttggttattgtgtttgatggttgtcgttggattaatctgggatgaacattttatatatagaagaat |
34353637 |
T |
|
| Q |
301 |
aaataattaaggaaga |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34353636 |
aaataattaaggaaga |
34353621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University