View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8120_high_2 (Length: 352)
Name: NF8120_high_2
Description: NF8120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8120_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 339
Target Start/End: Original strand, 18243950 - 18244288
Alignment:
| Q |
1 |
cttgttggaccacacctatattgagcaacttccgtggaaaattctgcagcnnnnnnnggacttatttgaagatcatgtagcacctactccaaggaagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18243950 |
cttgttggaccacacctatattgagcaacttccgtggaaaattctgcagctttttttggacttatttgaagatcatgtagcacctactccaaggaagtca |
18244049 |
T |
|
| Q |
101 |
aaaaattgaggagtttcaacagcatctggggtgtcatcaatcagaactttttcactgttttctgcattatgatgtgttgctgatgctgctgatgaatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18244050 |
aaaaattgaggagtttcaacagcatctggggtgtcatcaaccagaactttttcactgttttctgcattatgatgtgttgctgatgctgctgatgaatttg |
18244149 |
T |
|
| Q |
201 |
agaaaatttgaaaattgtgattgttttgattttgctttgtcatcaaatattgttgaggataatgatggtagaaaccatttagttgctgatattcatcttt |
300 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18244150 |
agaaaatgtgaaaattgtgattgttttgattttgctttgtcatcaaatattgttgaggataatgatggtagaaaccatttagttgttgatattcatcttt |
18244249 |
T |
|
| Q |
301 |
agtgccatcccagtatctgatctgattgaatggttcttc |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18244250 |
agtgccatcccagtatctgatctgattgaatggttcttc |
18244288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University