View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8120_high_7 (Length: 251)

Name: NF8120_high_7
Description: NF8120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8120_high_7
NF8120_high_7
[»] chr5 (2 HSPs)
chr5 (173-244)||(18243697-18243768)
chr5 (1-66)||(18243875-18243940)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 173 - 244
Target Start/End: Complemental strand, 18243768 - 18243697
Alignment:
173 ggatgcctaaaaatatgtctgaaacattctttgttactatggaatgtattgctaatctgtttagaataatat 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
18243768 ggatgcctaaaaatatgtctgaaacattctttgttactatggaatgtatggctaatctgtttagaataatat 18243697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 18243940 - 18243875
Alignment:
1 tcagaggcaaatagaaaggatagttgctttagtttggtgactgtgtcactttactcacgtggaacc 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18243940 tcagaggcaaatagaaaggatagttgctttagtttggtgactgtgtcactttactcacgtggaacc 18243875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University