View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8120_high_7 (Length: 251)
Name: NF8120_high_7
Description: NF8120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8120_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 173 - 244
Target Start/End: Complemental strand, 18243768 - 18243697
Alignment:
| Q |
173 |
ggatgcctaaaaatatgtctgaaacattctttgttactatggaatgtattgctaatctgtttagaataatat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18243768 |
ggatgcctaaaaatatgtctgaaacattctttgttactatggaatgtatggctaatctgtttagaataatat |
18243697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 18243940 - 18243875
Alignment:
| Q |
1 |
tcagaggcaaatagaaaggatagttgctttagtttggtgactgtgtcactttactcacgtggaacc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18243940 |
tcagaggcaaatagaaaggatagttgctttagtttggtgactgtgtcactttactcacgtggaacc |
18243875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University