View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8120_low_6 (Length: 276)
Name: NF8120_low_6
Description: NF8120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8120_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 2789253 - 2789511
Alignment:
| Q |
1 |
caaaacacgttaaaatatattgaatcatagggtgggaaaagtaactcnnnnnnnttgatttattttagaggcatgacctatagctataaaaagcccataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2789253 |
caaaacacgttaaaatatattgaatcatagggtgggaaaagtaactcaaaaaaattgatttattttagaggcatgacctatagctgtaaaaagcccataa |
2789352 |
T |
 |
| Q |
101 |
acaccaaaccaagtcatcctctgtagcggtttaccacgaagacctagaactcaaatcaatcatcaatcaaaatcgaaaatcttcgaagattcaaaaccct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2789353 |
acaccaaaccaagtcatcctctgtagcggtttaccgcgaagacctagaactcaaatcaatcatcaatcaaaatcgaaaatcttcgaagattcaaaaccct |
2789452 |
T |
 |
| Q |
201 |
aacccctctttctgcaaaatcaccgatttgtcacagaaatgcctcagagacattcgaag |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2789453 |
aacccctctttctgcaaaatcaccgatttgtcacagaaatgcctcagagacattcgaag |
2789511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University