View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8121_low_7 (Length: 277)
Name: NF8121_low_7
Description: NF8121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8121_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 36012214 - 36012471
Alignment:
| Q |
1 |
atgggaaatgcttgttatagcaaaaacaagcttccccaatccttcacgttccattttaaaagccaattccttacttaatggtaaccaacatttatgatat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36012214 |
atgggaaatgcttgttatagcgaaaacaagcttccccaatccttcacgtcccattttaaaagccaattccttacttaatggtaaccaacatttatgatat |
36012313 |
T |
|
| Q |
101 |
gtggtatcnnnnnnnnnnnnngttacaagtgaagtctcccatcgggataaattcgcgaggtatagcacctcccttttgctatatatggtggttgaacttt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36012314 |
gtggtatctttttttgtttttgttacaagtgaagtctcccatcgggataaattcgcgaggtatagcacctcccttttgctatatatggtggttgaacttt |
36012413 |
T |
|
| Q |
201 |
ttatattttgcattaaattaannnnnnnngttcgttaaagttactttaggcttcacttc |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36012414 |
ttatattttgcattaaattaattttttttgttcgtt-aagttactttaggcttcacttc |
36012471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 15550647 - 15550558
Alignment:
| Q |
17 |
atagcaaaaacaagcttccccaatccttcacgttccattttaaaagccaattccttacttaatggtaaccaacatttatgatatgtggta |
106 |
Q |
| |
|
||||| ||||||||| |||| ||||||||| | ||||||||| | ||||||||||| || ||||||| |||| |||| ||||||||| |
|
|
| T |
15550647 |
atagcgaaaacaagcatcccgaatccttcatgacccattttaataaccaattccttaatttatggtaattgacatatatggtatgtggta |
15550558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University