View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8121_low_9 (Length: 250)
Name: NF8121_low_9
Description: NF8121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8121_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 15952418 - 15952184
Alignment:
| Q |
1 |
agttgcataccttatggaacaccatgctgatgctggtgaagcannnnnnnnnc----cttctattccaagtggtgcattctggccattacaatgatgtag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15952418 |
agttgcataccttatggaacaccatgctgatgctggtgaagctttttttttctttttcttctattccaagtggtgcattctggccattacaatgatgtag |
15952319 |
T |
|
| Q |
97 |
ctttggagttcaatgcaaatttgggatgcttagtatcaaagttgaataaggaacacgatggatttcaattggtagatgcaaatgctgatgatttgctact |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15952318 |
ctttggagttcaatgcaaatttgggatgcttagtatcaaagttgaataaggaacacgatggatttcaattggtagatgcaaatgctgatgatttgctact |
15952219 |
T |
|
| Q |
197 |
gcaaattgttgcacaaccttctcacgccattcagg |
231 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
15952218 |
gcaaattgttgcacaaccttctaacgccattcagg |
15952184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 4 - 227
Target Start/End: Complemental strand, 10032586 - 10032367
Alignment:
| Q |
4 |
tgcataccttatggaacaccatgctgatgctggtgaagcannnnnnnnnccttctattccaagtggtgcattctggccattacaatgatgtagctttgga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10032586 |
tgcataccttatggaacaccatgctgatgctggtgaagc-cttttttttccttctgttccaagtggtgcatgctggccattacaatgatgtagctttgga |
10032488 |
T |
|
| Q |
104 |
gttcaatgcaaatttgggatgcttagtatcaaagttgaataaggaacacgatggatttcaattggtagatgcaaatgctgatgatttgctactgcaaatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10032487 |
gttcaatgcaaatttgggatgcttagtatcaaagttgaataagg---acgatggatttcaattggtagatgcaaatgctgatgatttgctactacaaatt |
10032391 |
T |
|
| Q |
204 |
gttgcacaaccttctcacgccatt |
227 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
10032390 |
gttgcacaaccttctcatgccatt |
10032367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 82 - 220
Target Start/End: Original strand, 26046109 - 26046247
Alignment:
| Q |
82 |
attacaatgatgtagctttggagttcaatgcaaatttgggatgcttagtatcaaagttgaataaggaacacgatggatttcaattggtagatgcaaatgc |
181 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
26046109 |
attacaatgatgtagctttagagttcaatgcaaaattgggatgcttagtatcaaagttgaataaggacctccatggatttcaattggtagatgcaaatgc |
26046208 |
T |
|
| Q |
182 |
tgatgatttgctactgcaaattgttgcacaaccttctca |
220 |
Q |
| |
|
| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26046209 |
ttatgatttgatactgcaaattgttgcacaaccttctca |
26046247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 42
Target Start/End: Original strand, 29926885 - 29926923
Alignment:
| Q |
4 |
tgcataccttatggaacaccatgctgatgctggtgaagc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29926885 |
tgcataccttatggaacaccatgctgatgctggtgaagc |
29926923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 37
Target Start/End: Original strand, 1637307 - 1637340
Alignment:
| Q |
4 |
tgcataccttatggaacaccatgctgatgctggt |
37 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
1637307 |
tgcataccttatggaaaaccatgctgatgctggt |
1637340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University