View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8122_high_11 (Length: 202)
Name: NF8122_high_11
Description: NF8122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8122_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 149 - 188
Target Start/End: Original strand, 35655853 - 35655892
Alignment:
| Q |
149 |
gggcagtaatttccaaagcataaactgcagcgaacacgaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35655853 |
gggcagtaatttccaaagcataaactgcagcgaacacgaa |
35655892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University