View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8122_low_15 (Length: 254)
Name: NF8122_low_15
Description: NF8122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8122_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 47038063 - 47037844
Alignment:
| Q |
18 |
tactataatacaattgggccagttacaaacttgtgaaggactgtgtttgattcatctgaaaaacaaattcccctttgttaactgtctactgccttaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47038063 |
tactataatacaattgggccagttacaaacttgtgaaggactgtgtttgattcatctgaaaaacaaattcccctttgttaactgtctactgccttaattt |
47037964 |
T |
|
| Q |
118 |
tgttggatcctttggtgctagatgaatcaaaatcttaaggatgattaattgattattagtatatcaaagtgtccttaagtcttgtatgcatttccttgtc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037963 |
tgttggatcctttggtgctagatgaatcaaaatcttaaggatgattaattgattattagtatatcaaagtgtccttaagtcttgtatgcatttccttgta |
47037864 |
T |
|
| Q |
218 |
taaccagattaataaacatc |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47037863 |
taaccagattaataaacatc |
47037844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University