View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8122_low_21 (Length: 204)
Name: NF8122_low_21
Description: NF8122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8122_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 44975951 - 44975772
Alignment:
| Q |
13 |
aagaatatgaaatatcccataataataccaaatcatccaaaacaacatatattccaaataaagaattaatgagatttaacatcacaaccaaagaggagag |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44975951 |
aagaaaatgaaatatcccataataataccaaatcatccaaaacaacatatattccaaataaagaattaatgagatttaacatcacaaccaaagaggagag |
44975852 |
T |
|
| Q |
113 |
aagaaagagtcaactttctcactttgaaacaaactt--tgtttgtggctgcatgcatgtatttcagatcatgatgatatt |
190 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44975851 |
aagaaagagtcaactttctaactttgaaacaaactttatgtttatggccgcatgcatgtatttcagatcatgatgatatt |
44975772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University