View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8122_low_23 (Length: 202)

Name: NF8122_low_23
Description: NF8122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8122_low_23
NF8122_low_23
[»] chr3 (1 HSPs)
chr3 (149-188)||(35655853-35655892)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 149 - 188
Target Start/End: Original strand, 35655853 - 35655892
Alignment:
149 gggcagtaatttccaaagcataaactgcagcgaacacgaa 188  Q
    ||||||||||||||||||||||||||||||||||||||||    
35655853 gggcagtaatttccaaagcataaactgcagcgaacacgaa 35655892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University