View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8122_low_9 (Length: 335)
Name: NF8122_low_9
Description: NF8122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8122_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 21933567 - 21933378
Alignment:
| Q |
12 |
cacacacgacaacatcagtactgatgaagtgaccaaattgtgttatgtgtcatttaatgcaaacaaaataacttggtttgtgtgcttaaatcttaatcac |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21933567 |
cacacacaacaacatcagtactgatgaagtgaccaaattgtgttatgtgtcatttaatgcaaacaaaataacttggtttgtgtgcttaaatcttaatcac |
21933468 |
T |
|
| Q |
112 |
attcttgtctctttcattattattattactac---taccataccatccactagccaataactattaactaagtggtatggctatcattgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21933467 |
attcttgtctctttcattattattattactaccaataccataccatccactagccaataactattaactaagtggtatggctatcattgg |
21933378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 21933300 - 21933257
Alignment:
| Q |
276 |
attcttttgcaaattatagcaaaatgagttctgaagaaaataaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21933300 |
attcttttgcaaattatagcaaaatgagttctgaagaaaataaa |
21933257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University