View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8123_high_1 (Length: 717)

Name: NF8123_high_1
Description: NF8123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8123_high_1
NF8123_high_1
[»] chr6 (1 HSPs)
chr6 (655-697)||(33235502-33235544)


Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 655 - 697
Target Start/End: Complemental strand, 33235544 - 33235502
Alignment:
655 tacccaacgaaaatgacaagagcatcgacaattaatgggatgg 697  Q
    |||||||||||||||||||||||||||||||||||||||||||    
33235544 tacccaacgaaaatgacaagagcatcgacaattaatgggatgg 33235502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University