View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8123_high_1 (Length: 717)
Name: NF8123_high_1
Description: NF8123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8123_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 655 - 697
Target Start/End: Complemental strand, 33235544 - 33235502
Alignment:
| Q |
655 |
tacccaacgaaaatgacaagagcatcgacaattaatgggatgg |
697 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33235544 |
tacccaacgaaaatgacaagagcatcgacaattaatgggatgg |
33235502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University