View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8123_low_11 (Length: 354)
Name: NF8123_low_11
Description: NF8123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8123_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 350
Target Start/End: Complemental strand, 34685671 - 34685347
Alignment:
| Q |
16 |
taagaataagaataaccagcaaagaagggaaaacaagcactcaccctatttgcccgactagggaagagacgaggctttatgatgagatttctgagcattt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685671 |
taagaataagaataaccagcaaataagggaaaacaagcactcaccctatttgcccgactagggaagagacgaggctttatgatgagatttctgagcattt |
34685572 |
T |
 |
| Q |
116 |
gaatagatttggcgttgccattgccaacaatcacttcatcctctttctcataactgctgctcttgcagctttcaatctctccacacatagtaaatatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685571 |
gaatagatttggcgttgccattgccaacaatcacttcatcctctttctcataactgctgctcttgcagctttcaatctctccacacatagtaaatatatt |
34685472 |
T |
 |
| Q |
216 |
------gcggcggcggcgatgaacagaacgggagaagaaacggaaggtctcttgaaataggttacgtggagctcaagtttgtatataaaccgcctcggat |
309 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34685471 |
gcagcggcggcggcggctatgaacagaacgggagaagaaacggaaggtctcttgaaataggttacgtggagctcaagttt----------------ggat |
34685388 |
T |
 |
| Q |
310 |
cgaccgggtggaccggtaggtaatgctcgaaaacccaaaaa |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685387 |
cgaccgggtggaccggtaggtaatgctcgaaaacccaaaaa |
34685347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 34685692 - 34685663
Alignment:
| Q |
1 |
caacgaaaaaagaagtaagaataagaataa |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34685692 |
caacgaaaaaagaagtaagaataagaataa |
34685663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University