View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8123_low_21 (Length: 240)
Name: NF8123_low_21
Description: NF8123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8123_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 3856455 - 3856243
Alignment:
| Q |
1 |
cctgataagaggtagaattgaagtcttttgggtttgaaggaacgaaatgttatggaactataannnnnnnnncttataaattttttcggttaggtagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3856455 |
cctgataagaggtagaattgaagtcttttgggtttgaaggaacgaaatgttatggaactataatttttttttcttataaattttttcggttaggtagata |
3856356 |
T |
|
| Q |
101 |
actaaatatgatatagtttaatttgatagagatggagcaaaatcagccctctaggtggtaggagataaatatcatgtaagattgtccaactagatatttt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856355 |
actaaatatgatatagtttaattagatagagatggagcaaaatcagccctctaggtggtaggagataaatatcatgtaagattgtccaactagatatttt |
3856256 |
T |
|
| Q |
201 |
ttggtgaataata |
213 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
3856255 |
ttgctgaataata |
3856243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University