View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8124_high_2 (Length: 471)
Name: NF8124_high_2
Description: NF8124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8124_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 416; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 416; E-Value: 0
Query Start/End: Original strand, 14 - 457
Target Start/End: Complemental strand, 3200389 - 3199946
Alignment:
| Q |
14 |
tggacatcaacgaatttatgtatttgagacttatttgattaagatgagacggctgaaattcaagttcggtatcttttgactcataaaatttaaatctaaa |
113 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3200389 |
tggaaatcaacgaatttacgtatttgagacttatttgattaagattagacggctgaaattcaagttcggtatcttttgactcataaaatttaaatctaaa |
3200290 |
T |
|
| Q |
114 |
tttttgtgaacctttgatgatggaatggatatggatatttcacatgacaatgttgcttcctttggacaactttcggattttgatgggaccttatacctta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3200289 |
cttttgtgaacctttgatgatggaatggatatggatatttcacatgacaatgttgcttcccttggacaactttcagattttgatgggaccttatacctta |
3200190 |
T |
|
| Q |
214 |
ttgtgtgtgggtgcagccttataccttattggataaacctaaaatgtgagatacaattttctaaagaaaagtcatatacaagctattaagccaatttcaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3200189 |
ttgtgtgtgggtgcagccttataccttattggataaacctaaaatgtgagatacaattttctaaagaaaagtcatatacaagctattaagccaatttcaa |
3200090 |
T |
|
| Q |
314 |
tatctaatattcaggttaatgtccaatttctcggcaaatttcatgatgccaagaagggttcagctggttgttacttgtggctttaagttaatggaccccg |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3200089 |
tatctaatattcaggttaatgtccaatttctcggcaaatttcatgatgccaagaagggttcagctggttgttacttgtggctttaagttaatggacccca |
3199990 |
T |
|
| Q |
414 |
gaagtaatcttgcctaatttatattagggtcatgctaaccaagt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3199989 |
gaagtaatcttgcctaatttatattagggtcatgctaaccaagt |
3199946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University