View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8124_low_7 (Length: 243)
Name: NF8124_low_7
Description: NF8124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8124_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 35394179 - 35394029
Alignment:
| Q |
1 |
atgaaccataggttgtccagctaatggaaagagtggtttaggaatgttgaatgataatggacggaatcgagtgcctttggtgggtcctccaaccatgata |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394179 |
atgaaccattggttgtccagctaatggaaagagtggtttaggaatgttgaatgataatggacggaatcgagtgcctttggtgggtcctccaaccatgata |
35394080 |
T |
 |
| Q |
101 |
accgccacaactctctcttctgcaatccccatcttattcgagatccacaat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394079 |
accgccacaactctctcttctgcaatccccatcttattcgagatccacaat |
35394029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 35393998 - 35393944
Alignment:
| Q |
173 |
tgagtttcagaaattacaatgaggttgttgttgtgttgtgttaaatgttattatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393998 |
tgagtttcagaaattacaatgaggttgttgttgtgttgtgttaaatgttattatt |
35393944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University