View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8125_high_16 (Length: 211)
Name: NF8125_high_16
Description: NF8125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8125_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 7963510 - 7963437
Alignment:
| Q |
17 |
aatctactggtcaactcactttcccgtgaatcgtatataaacataaatcattttactttacattaattttaact |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7963510 |
aatctactggtcaactcactttcccgtgaatcgtatataaacataaatcattttactttacattaattttaact |
7963437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 196
Target Start/End: Complemental strand, 7963369 - 7963331
Alignment:
| Q |
158 |
catttattatgccaaatggagaggatctttacccttctt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7963369 |
catttattatgccaaatggagaggatctttacccttctt |
7963331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 29341080 - 29341113
Alignment:
| Q |
158 |
catttattatgccaaatggagaggatctttaccc |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
29341080 |
catttattataccaaatggagaggatctttaccc |
29341113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 23474196 - 23474229
Alignment:
| Q |
158 |
catttattatgccaaatggagaggatctttaccc |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
23474196 |
catttattatgctaaatggagaggatctttaccc |
23474229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 32618885 - 32618918
Alignment:
| Q |
158 |
catttattatgccaaatggagaggatctttaccc |
191 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
32618885 |
catttattatgccaaatgaagaggatctttaccc |
32618918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University