View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8125_low_10 (Length: 246)
Name: NF8125_low_10
Description: NF8125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8125_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 10327726 - 10327545
Alignment:
| Q |
1 |
acactccgatagatttaagcttttgcttgtcnnnnnnnnnnttaagcttgcaattgtgtgtcccacatcggaagttttgtgaaggacaaaagcaagtaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10327726 |
acactccgatagatttaagcttttgcttgtcaaaaaaaaa-ttaagcttgcaattgtgtgtcccacatcggaagttttgtgaaggacaaaagcaagtaac |
10327628 |
T |
 |
| Q |
101 |
ctataaaaagaggcgtgtacagtacatacatatatacaatggcaatggaata-----actaatagtagtattaattaattgattt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
10327627 |
ctataaaaagaggcgtgtacagtacataca--tatacaatggcaatggaataacattactaatagaagtattaattaattgattt |
10327545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 10327497 - 10327443
Alignment:
| Q |
181 |
gtttatgagctatttttgtgctcagtaaaaccatagttatcttcacttggttcat |
235 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
10327497 |
gtttatgagctatttttgtgctcattaaaaccatagttgtcttcacttggttcat |
10327443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 127
Target Start/End: Complemental strand, 1225069 - 1224983
Alignment:
| Q |
42 |
ttaagcttgcaattgtgtgtcccacatcggaagttttgtgaaggaca-aaagcaagtaacctataaaaagaggcgtgtacagtacat |
127 |
Q |
| |
|
|||||||||||||| | |||||||||||| || ||| |||||| || ||||||| | |||||||||||||||||||| |||||| |
|
|
| T |
1225069 |
ttaagcttgcaattttatgtcccacatcgaaaatttcgtgaagaacggaaagcaacttgtctataaaaagaggcgtgtactgtacat |
1224983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 123
Target Start/End: Complemental strand, 17440818 - 17440753
Alignment:
| Q |
59 |
tgtcccacatcggaagttttgtgaaggaca-aaagcaagtaacctataaaaagaggcgtgtacagt |
123 |
Q |
| |
|
||||||||||||| |||||| ||| ||| | ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
17440818 |
tgtcccacatcggtagttttatgatggatacaaagcaagtgatctataaaaagaggcgtgcacagt |
17440753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University