View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8125_low_11 (Length: 244)
Name: NF8125_low_11
Description: NF8125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8125_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 50 - 221
Target Start/End: Complemental strand, 2307530 - 2307359
Alignment:
| Q |
50 |
catatttctgcagaagataggtgctgcaagtgcaattagatatctctaacnnnnnnntccccccatttttctgcttatcaagttttactttgttttttca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2307530 |
catatttctgcagaagataggtgctgcaagtgcaattagatatctctaacaaaaaaatccccccatttttctgcttatcaagttttactttgttttttca |
2307431 |
T |
|
| Q |
150 |
atcaagattgctaataaaatgtgagtcctaatattacatcatatcatggactcaaagttaagggcatctctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2307430 |
atcaagattgctaataaaatgtgagtcctaatattacatcatatcatggactcaaagttaagggcatctctt |
2307359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 141 - 176
Target Start/End: Complemental strand, 2316609 - 2316574
Alignment:
| Q |
141 |
gttttttcaatcaagattgctaataaaatgtgagtc |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2316609 |
gttttttcaatcaagattgttaataaaatgtgagtc |
2316574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 141
Target Start/End: Complemental strand, 2316682 - 2316648
Alignment:
| Q |
107 |
tccccccatttttctgcttatcaagttttactttg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2316682 |
tccccccatttttctgcttatcaagttttgctttg |
2316648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University