View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8125_low_16 (Length: 230)
Name: NF8125_low_16
Description: NF8125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8125_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 55162019 - 55162217
Alignment:
| Q |
19 |
atagcaagtcaatcactgcagccatttactcatcaccaatggagaatcaaccaacaatatatcatcaacactgtgagtcagtccaagctaatcttcactt |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162019 |
atagcaagtcaatcattgcagccatttactcagcaccaatggagaatcaaccaacaatatatcatcaacactgtgagtcagtccaagctaatcttcactt |
55162118 |
T |
|
| Q |
119 |
cagcactcacacttcaaattaaaaac-----aatttggtgtctcataggtaaggtatatattaaaagatatatagaagaatctaattatagttttgtctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162119 |
cagcactcacacttcaaattaaaaacaatttaatttggtgtctcat-----aggtatatattaaaagatatatagaagaatctaattatagttttgtctc |
55162213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University