View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8127_high_20 (Length: 267)
Name: NF8127_high_20
Description: NF8127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8127_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 36021714 - 36021533
Alignment:
| Q |
20 |
ttttatcctaccagccaaatcataaattattttttaaaattagatatgataaaagtcaaagtcttttaatgatcgaaagaaatataattggttgacagta |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
36021714 |
ttttatcctagcagccaaatcataaattattttttaaaattagatatgataagagtcaaagtcttttaatgatcgaaag-aatataattggttgaccgtg |
36021616 |
T |
 |
| Q |
120 |
taattgttttacaatattttgaacgtaacaatttannnnnnnatgcaggaaataactaatataatatcaggatcatatgagtc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36021615 |
taattgttttacaatattttgaacgtaacgatttatttttttatgcaggaaataactaatataatctcaggatcatatgagtc |
36021533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 36021537 - 36021493
Alignment:
| Q |
214 |
gagtcttgtataagaaaacaaataaaccgcaaaaaatagtataat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36021537 |
gagtcttgtataagaaaacaaataaaccgcaaaaaatagtctaat |
36021493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University