View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8127_high_28 (Length: 237)

Name: NF8127_high_28
Description: NF8127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8127_high_28
NF8127_high_28
[»] chr4 (1 HSPs)
chr4 (1-223)||(42003268-42003490)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42003490 - 42003268
Alignment:
1 gttccatggaaatgattcagtttctccaaccttattggccccggagagaaaaacatttgacttctccgacacaccagctgaaacacttggtgaaacaacc 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42003490 gttccatggaaatgattcagtttctccaaccttattgggcccggagagaaaaacatttgacttctccgacacaccagctgaaacacttggtgaaacaacc 42003391  T
101 atgtttggttttgtttcttcatgggataaaatcgaagatgacgaggagacgtgagcatgagggacactaacgttgtcggaagctttgtagccactaaagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
42003390 atgtttggttttgtttcttcatgggataaaatcgaagatgacgaggacacgtgagcatgagggacactaacgttgtcggaagctttgtagccactgaagg 42003291  T
201 ctattagagaagcaagtaaaaac 223  Q
    |||||||||||||||||||||||    
42003290 ctattagagaagcaagtaaaaac 42003268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University