View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8127_low_10 (Length: 410)
Name: NF8127_low_10
Description: NF8127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8127_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 315 - 392
Target Start/End: Complemental strand, 10714955 - 10714878
Alignment:
| Q |
315 |
ctatgattctccagcagcaatctttgaggaggagtgaattgtggatacaccaattcttgtccatggaaatctctgact |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10714955 |
ctatgattctccagcagcaatctttgaggaggagtgaattgtggatacaccaattcttgtccatggaaatctctgact |
10714878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University