View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8127_low_33 (Length: 207)
Name: NF8127_low_33
Description: NF8127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8127_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 32593140 - 32593296
Alignment:
| Q |
21 |
cttattactgtaaatacaaaataaaggatattgactatgttacattaaaagattttaaaaactgatactatattgcaaaaatatttgaacatattggctg |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32593140 |
cttattactgtaaatacaa--taaaggatattgactatgttacattaaaagattttaaaaactgatactatagtgcaaaa-----------tattggctg |
32593226 |
T |
 |
| Q |
121 |
cctaatgttatgtactaaatttgcaattgaaattctggctgatgcatttaggctcttgaaccatcttgtt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32593227 |
cctaatgttatgtactaaatttgcaattgaaattctggctgatgcatttaggctcttgaaccatcttgtt |
32593296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 58 - 115
Target Start/End: Original strand, 32603993 - 32604050
Alignment:
| Q |
58 |
tgttacattaaaagattttaaaaactgatactatattgcaaaaatatttgaacatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| |||||| ||||||| |
|
|
| T |
32603993 |
tgttacattaaaagattttaaaaaatgatactatgttgcaaaactatttgtacatatt |
32604050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University