View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8127_low_9 (Length: 410)
Name: NF8127_low_9
Description: NF8127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8127_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 41 - 392
Target Start/End: Complemental strand, 13925349 - 13924998
Alignment:
| Q |
41 |
accttatttaatccctcgcttgacgagttcttccacacaacctaccctctctcttccgtctttacagaagtaagccctactgccattgccacacaatacc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13925349 |
accttatttaatccctcgcttgacgagttcttccacacaacctaccctttctcttccgtctttacagaagtaacccctactgccattgccacacaatacc |
13925250 |
T |
 |
| Q |
141 |
cttcgaacaaacaaaaccttgatctcattgttgggtcttgccacggaatcatatgtttcgacctggatcgaggtttcactctattgtggaacccttccat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13925249 |
cttcgaacaaacaaaaccttgatctcattgttgggtcttgccatataatcatatgtttcgacctggatcgaggtttcactctattgtggaacccttccat |
13925150 |
T |
 |
| Q |
241 |
aagaaaattttccgagttgccttcctctttggatgatccacaccgactgcgagctcacgtaacatatggctttggctatgattatttcagtggtgctttt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13925149 |
aagaaaattttccgagttgccttcctctttggatgaaccacaccgactgcgagctcacgtaacatatggctttggctatgattatttcagtggtgctttt |
13925050 |
T |
 |
| Q |
341 |
aaggttgtttccttttctggctatagtagtggcagtttggatggcaaggttt |
392 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13925049 |
caggttgttgccttttctggctatagtagtggcagtttggatggcaaggttt |
13924998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University