View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8128_high_14 (Length: 208)
Name: NF8128_high_14
Description: NF8128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8128_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 13855286 - 13855461
Alignment:
| Q |
20 |
tgagaaaccggtggcggttagtgtgaaggagtttgatgagattgtgaaggtgtgtgaggagtgtggggtgcagtttatggatgggactatgtggatgcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13855286 |
tgagaaaccggtggcggttagtgtgaaggagtttgatgagattgtgaaggtgtgtgaggagtgtggggtgcagtttatggatgggactatgtggatgcat |
13855385 |
T |
 |
| Q |
120 |
catccgagaacggaggtgatgaaggagtttttggaggatggggagaagtttggaaaggttaaatcggtatgtgtct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13855386 |
catccgagaacggaggtgatgaaggagtttttggaggatggggagaagtttggaaaggttaaatcggtatgtgtct |
13855461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 21 - 193
Target Start/End: Original strand, 13849497 - 13849669
Alignment:
| Q |
21 |
gagaaaccggtggcggttagtgtgaaggagtttgatgagattgtgaaggtgtgtgaggagtgtggggtgcagtttatggatgggactatgtggatgcatc |
120 |
Q |
| |
|
||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13849497 |
gagaagccggtggctgtgagtgtgaaggagtttgatgagattgtgaaggtgtgtgaggagtgtggggtgcagtttatggatgggactatgtggatgcatc |
13849596 |
T |
 |
| Q |
121 |
atccgagaacggaggtgatgaaggagtttttggaggatggggagaagtttggaaaggttaaatcggtatgtgt |
193 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
13849597 |
atcctagaacagaggtgatgaaggggtttttggaggatggagagaagtttggcaaggttaaatcggtatgtgt |
13849669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University