View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8128_high_5 (Length: 332)
Name: NF8128_high_5
Description: NF8128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8128_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 20701689 - 20701781
Alignment:
| Q |
222 |
tcagaaagtaaccgctttgtgtatgaaatgtgtattcgagacgccgaaggctgctttgttcatgcaagttctgcacattttgaaggcagccaa |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20701689 |
tcagaaagtaactgctttgtgtatgaaatgtgtattcgagacaccgaaggctgctttgttcatgcaagttctgcacattttgaaggcagccaa |
20701781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University