View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8128_low_17 (Length: 230)
Name: NF8128_low_17
Description: NF8128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8128_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 1865814 - 1866032
Alignment:
| Q |
1 |
agcaattctggatcatacaaagacttcttctaatgaactattgtctagaaattttagctttccagaagagtcttctcatgcttctttgtttttaggtatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1865814 |
agcaattctggatcatacaaagacttcttctaatgaactattgtctagaaattttagctttccagaagagtcttctcatgcttctttgtttttaggtatg |
1865913 |
T |
|
| Q |
101 |
tattctctcttatgtttatgtggattaatgtgacccatttttcaattgttacatataaaaatgtattcttagttacaaagtatagtttgaattaatcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1865914 |
tattctctcttatgtttatgtggattaatgtgacccatttttcaattgttacatataaaaatgtattcttagttacaaagtatagtttgaattaatcaat |
1866013 |
T |
|
| Q |
201 |
gcaggtagtagttcatctc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1866014 |
gcaggtagtagttcatctc |
1866032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University