View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8129_high_15 (Length: 229)
Name: NF8129_high_15
Description: NF8129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8129_high_15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 37661899 - 37662127
Alignment:
| Q |
1 |
tcaaaactcaaacatggcttcatcatattcatgttggtgttggtttccaatctacttcatagcatctgtagcacttggtgtcatagcaatcacttcagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
37661899 |
tcaaaactcaaacatggcttcatcatattcatgttggtgttggtttccaatctacttcatagcatctgtagcacttggtgtcatagctatcacctcagca |
37661998 |
T |
|
| Q |
101 |
atacactcaaattccaaatcctcccctcaagaaatccctccacaaactcacacactctcaacaaacgcaacagaagcactcaaaaaacaaggttttgttc |
200 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37661999 |
atacactcaaattccaaatcctcgcctgaagtaatcccatcacaaactcacacactctcaacaaacgcaacagaagcactcaaaaaacaaggttttgttc |
37662098 |
T |
|
| Q |
201 |
ttatggctgatcttcttcatcgttcacca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37662099 |
ttatggctgatcttcttcatcgttcacca |
37662127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University