View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8129_high_16 (Length: 227)
Name: NF8129_high_16
Description: NF8129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8129_high_16 |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 27574702 - 27574778
Alignment:
| Q |
24 |
agaaagcatattcttctcaaattggttgcccttctcttcattttctaggtacatcatctgcctctctactttcaatttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27574702 |
agaaagcatattcttctcaaattggttgcccttctcttcattttctaggtacatcatctgcctctc--ctttcaatttg |
27574778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 172079 - 172135
Alignment:
| Q |
99 |
tttgatagtatgaaatcacgttctccccttagatcggtcatgtattttgaatttgat |
155 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
172079 |
tttgatagtaagaaatcccgttctccctttagatcggtcctgtatttagaatctgat |
172135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 6926852 - 6926796
Alignment:
| Q |
99 |
tttgatagtatgaaatcacgttctccccttagatcggtcatgtattttgaatttgat |
155 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
6926852 |
tttgatagtaagaaatcccgttctccctttagatcggtcctgtatttagaatctgat |
6926796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 502109 - 502053
Alignment:
| Q |
99 |
tttgatagtatgaaatcacgttctccccttagatcggtcatgtattttgaatttgat |
155 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
502109 |
tttgatagtaagaaatcccgttctccctttagatcggtcctgtatttagaatctgat |
502053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 13674465 - 13674521
Alignment:
| Q |
99 |
tttgatagtatgaaatcacgttctccccttagatcggtcatgtattttgaatttgat |
155 |
Q |
| |
|
|||||||||| ||||||| |||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
13674465 |
tttgatagtaagaaatcatgttctccctttagatcggtcctgtatttagaatctgat |
13674521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 20482749 - 20482805
Alignment:
| Q |
99 |
tttgatagtatgaaatcacgttctccccttagatcggtcatgtattttgaatttgat |
155 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
20482749 |
tttgatagtaagaaatcctgttctccctttagatcggtcctgtatttagaatctgat |
20482805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University