View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8129_low_10 (Length: 293)
Name: NF8129_low_10
Description: NF8129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8129_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 275
Target Start/End: Complemental strand, 43144955 - 43144696
Alignment:
| Q |
16 |
taaatgtcagtggtggagatgcaacttctaacaatgcggaatataatttatttttggatttatatgtcacttgtgatcattacagacaaacctgttttgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43144955 |
taaatgtcagtggtggagatgcaacttgtaacaatgcggaatataatttatttttggatttatatgtcacttgtgatcattacagacaaacctgttttgt |
43144856 |
T |
 |
| Q |
116 |
ctattttattttaacatccctcaagatgataacatgattaaaattatacaaactacttgtttacaaatttcatattacacaaataaaattccacactaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43144855 |
ctattttattttaacatccctcaagatgataacatgattaaaattatacaaactacttgtttacaaatttcatattacacaaatataattccacactaat |
43144756 |
T |
 |
| Q |
216 |
gataacttgagaacataatcatgaatagaacattaaagtttctaatctaacattgcagct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43144755 |
gataacttgagaacataatcatgaatagaacattaaagtttctaatctaacattgcagct |
43144696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University