View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8129_low_17 (Length: 247)
Name: NF8129_low_17
Description: NF8129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8129_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 232
Target Start/End: Original strand, 443143 - 443354
Alignment:
| Q |
22 |
taggggaacatttttgttgatgttgttgttcagattgtgtttgagttttctcaattgcattagagagtaacttgtgtgtatgtcgtgctaa-tacccaat |
120 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
443143 |
taggggaacattcttgttgatgttgttgttcagattgtgtttgagttttctcaattgcattagagagtaacttgtgtgtatgtcgtgctaagtacccaat |
443242 |
T |
|
| Q |
121 |
ttaaggaaactataattttggtttctgagtttttaagcactagtcatatactcatatcatatataacaatccctaaatttattattcattagtgattagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
443243 |
ttaaggaaactataattttggtttctgagtttttaagcactagtcatatactcatatcatatataacaatccctaaatttatcattcattagtgattagt |
443342 |
T |
|
| Q |
221 |
caattggtctct |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
443343 |
caattggtctct |
443354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 29571791 - 29571722
Alignment:
| Q |
35 |
ttgttgatgttgttgttcagattgtgtttgagttttctca---attgcattagagagtaacttgtgtgta |
101 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||| |
|
|
| T |
29571791 |
ttgttgaggttcttgttcagattgtgtttgagtttgctcaattattgcattagaaagtaacttgtgtgta |
29571722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University