View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8130_high_14 (Length: 241)
Name: NF8130_high_14
Description: NF8130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8130_high_14 |
 | |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 113 - 241
Target Start/End: Original strand, 33857495 - 33857623
Alignment:
| Q |
113 |
agcgagtgcattgctcttgactggagtttgttgccttcacatcggctatgctaaagcggttattcactgtgacgtgaactctgcaaatatcttgcttgac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||| |||||||||||||||||||| || ||| |
|
|
| T |
33857495 |
agcgagtgcattgctcttgactggagtttgttgccttcacgtcggctatgccaaagcggttattcaccgtgaagtgaactctgcaaatatcttactcgac |
33857594 |
T |
|
| Q |
213 |
aagaacctattgactaaagttgctgattt |
241 |
Q |
| |
|
|||||||||||| ||||||| ||||||| |
|
|
| T |
33857595 |
aagaacctattgcttaaagtttctgattt |
33857623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 33856934 - 33857016
Alignment:
| Q |
19 |
tgtcatacatatataaggtttaatcctttttattttattttatattcttcgaccttaatattccaaaacttaatgtttgagtg |
101 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
33856934 |
tgtcatacatatataatgtttaatcctttttattttattttatattcttcaaccttaatattccaaaactaaatgtttgagtg |
33857016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 146 - 241
Target Start/End: Complemental strand, 41048781 - 41048686
Alignment:
| Q |
146 |
ccttcacatcggctatgctaaagcggttattcactgtgacgtgaactctgcaaatatcttgcttgacaagaacctattgactaaagttgctgattt |
241 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| |||||||| || |||||||||||||||| |
|
|
| T |
41048781 |
ccttcacactggctatgctaaagcggttattcatcgtgacgtgaagtctgcaaatatcttacttgatgagaacctaatggctaaagttgctgattt |
41048686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 211
Target Start/End: Complemental strand, 41044300 - 41044235
Alignment:
| Q |
146 |
ccttcacatcggctatgctaaagcggttattcactgtgacgtgaactctgcaaatatcttgcttga |
211 |
Q |
| |
|
|||||||| | || ||||||||||| |||||||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
41044300 |
ccttcacagcagcaatgctaaagcgtttattcaccatgacgtgaagtctgcaaatatcttacttga |
41044235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University