View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8130_high_7 (Length: 356)
Name: NF8130_high_7
Description: NF8130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8130_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 42941922 - 42941582
Alignment:
| Q |
1 |
tgtaaatgacatgacgattaatgtcattgttgttaataataagttgacctaaaatcaacctaaaatgaataggatcaattaaggtagccaatgcctaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42941922 |
tgtaaatgacatgacgattaatgtcattgttgttaataataagttgacctaaaatcaacttaaaatgaataggatcaattaaggtagccagtgcctaatg |
42941823 |
T |
 |
| Q |
101 |
ctgcttgctattattttacctcagcagttggagagtttgctgggaaatgatatgtgatgactgaatgtttcttgaagtacttagactggaaaaattcaat |
200 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42941822 |
ctgcttgctact---ttacctcagcagttggagagtttgctgggaaatgatatgtgatgactgaatgtttcttgaagtacttagactggaaaaattcaat |
42941726 |
T |
 |
| Q |
201 |
tactttttccaaagcttcttcttcttcatcctcatatttgtcatcggctgccaaacggtccctaacagcagtctcaatctgaacaccatactgtgcaccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42941725 |
tactttttccaaagcttcttcttcttcatcctcatatttgtcatcggctgccaaacggtccctaacagcagtctcaatctgaacaccatactgtgcaccc |
42941626 |
T |
 |
| Q |
301 |
ttaatctctttaatcacaacaagtctaattgccttctccacagg |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42941625 |
ttaatctctttaatcacaacaagtctaattgccttctccacagg |
42941582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University