View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8130_low_10 (Length: 332)
Name: NF8130_low_10
Description: NF8130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8130_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 62 - 320
Target Start/End: Original strand, 43171024 - 43171284
Alignment:
| Q |
62 |
ttgataattgttctagttctgaactaatgatgacatatagagattgtgataaatcattagttataaaaacctagctgtataactatttcaacgatg-nnn |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43171024 |
ttgataattgttctagttctgaactaatgatgacatatagagattgtgataaatcattagttataaaaacctagctgtataactatttcaacgatgtttt |
43171123 |
T |
 |
| Q |
161 |
nnnnncaacaatgttacccctgattcgcaaatatcctaaatttccattg-nnnnnnntatagaaagaggaaaatagtaaaaccaattggaaggaaatgaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43171124 |
tttttcaacaatgttacccctgattcgcaaatatcctaaatttccattgaaaaaaaatatagaaagaggaaaatagtaaaaccaattggaaggaaatgaa |
43171223 |
T |
 |
| Q |
260 |
agctgattctaatatattagcaagaggcagcagcaataattgcacccaggatggacccaaa |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43171224 |
agctgattctaatatattagtaagaggcagcagcaacaattgcacccagtatggacccaaa |
43171284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University