View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8130_low_8 (Length: 336)
Name: NF8130_low_8
Description: NF8130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8130_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 57 - 324
Target Start/End: Original strand, 17106731 - 17107007
Alignment:
| Q |
57 |
tgagaattttaaatttgacagtgattaatgtgttcgcaaagacactattttcttgattta----taacttgcccgagagatggttacacaggctgaagga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| | || |
|
|
| T |
17106731 |
tgagaattttaaatttgacagtgattaatgtgttcgcaaacacactattttcttgatttaactttaacttgcccgagagatggttacacaggctgcatga |
17106830 |
T |
 |
| Q |
153 |
gtcatttgccgagttaacatttcatctggttatgatcttgtcatcttgtaatgttataacatcatcaaggcttgatgc------atgtgttcgtacgtat |
246 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
17106831 |
gtcatt-gccgagttaacatttcatcttgttatgatcttgtcatcttgtaatgttataacatcatcaaggcttgatgcatctcaatgtgttcttacgtat |
17106929 |
T |
 |
| Q |
247 |
gtgtgttcaatttcatttgcttttagaacctttctcataatgcatgtttctgtactcattggtacgtttttatgatgt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
17106930 |
gtgtgttcaatttcatttgcttttagaacctttctcataatgcatgtttctgtactcattcgtacgtttttattatgt |
17107007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 17106651 - 17106711
Alignment:
| Q |
1 |
tgatgtatagagaatatgaatatcttatctactataattgtttgttttgaatttattgaga |
61 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106651 |
tgatgtatagaaaatatgaatatcttatctactataattgtttgttttgaatttattgaga |
17106711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University