View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8130_low_9 (Length: 334)
Name: NF8130_low_9
Description: NF8130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8130_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 229
Target Start/End: Complemental strand, 24229138 - 24228933
Alignment:
| Q |
24 |
ggggaacaggtgaggagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtggttgtcgaagagggtga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24229138 |
ggggaacaggtgaggagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtggttgtcgaagagggtga |
24229039 |
T |
|
| Q |
124 |
tgttgaagggtgatggtgtgagatttgggttggggattggcatgttaatgggattgtcgttttggtcaacgagggtgatcggcattttgaaatttggttg |
223 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24229038 |
tgttgaagggtgatggtgtggggtttgggttggggattggcatgtagatgggattgtcgttttggtcaacgagggtgatcggcattttgaaatttgggtg |
24228939 |
T |
|
| Q |
224 |
attggt |
229 |
Q |
| |
|
|||||| |
|
|
| T |
24228938 |
attggt |
24228933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 38 - 142
Target Start/End: Original strand, 24225003 - 24225107
Alignment:
| Q |
38 |
gagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtggttgtcgaagagggtgatgttgaagggtgat |
137 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||| |||| ||||||| |||||||| || |||||| |||| ||| | | |
|
|
| T |
24225003 |
gagggattggattgtgaaggtggagtcgaaggtgatggagtaggtgtcgtgggtatcgtgagggaggttgttgtcgatgatggtgattttgatgggagtt |
24225102 |
T |
|
| Q |
138 |
ggtgt |
142 |
Q |
| |
|
||||| |
|
|
| T |
24225103 |
ggtgt |
24225107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University