View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8131_low_9 (Length: 251)

Name: NF8131_low_9
Description: NF8131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8131_low_9
NF8131_low_9
[»] chr8 (1 HSPs)
chr8 (80-140)||(25143280-25143340)
[»] chr7 (1 HSPs)
chr7 (80-141)||(31039377-31039438)
[»] chr2 (1 HSPs)
chr2 (82-141)||(28164531-28164590)
[»] chr3 (1 HSPs)
chr3 (80-140)||(27262367-27262427)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 80 - 140
Target Start/End: Complemental strand, 25143340 - 25143280
Alignment:
Q  80 agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaag 140  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
T  25143340 agtttttagacccggatttggatctagatctagatccgttttgtggttgctgctgagaaag 25143280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 80 - 141
Target Start/End: Complemental strand, 31039438 - 31039377
Alignment:
Q  80 agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaagc 141  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||||    
T  31039438 agtttttagacccggatttggatctagatctagatccgttttgtggttgctgttgagaaagc 31039377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 82 - 141
Target Start/End: Original strand, 28164531 - 28164590
Alignment:
Q  82 tttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaagc 141  Q
    |||||||||||| ||||| ||||||||||||||  ||||||||||||||| |||||||||    
T  28164531 tttttagacccgaatttgaatctagatctagatccgttttgtggttgctgttgagaaagc 28164590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 140
Target Start/End: Complemental strand, 27262427 - 27262367
Alignment:
Q  80 agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaag 140  Q
    ||||||||||  |||||||||||||||||||||||   ||||||| | | |||||||||||    
T  27262427 agtttttagattcggatttggatctagatctagatcccttttgtgatggttgctgagaaag 27262367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University