View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8132_high_11 (Length: 441)
Name: NF8132_high_11
Description: NF8132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8132_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 1 - 425
Target Start/End: Complemental strand, 27332711 - 27332287
Alignment:
| Q |
1 |
ctcaacaagaagtgaattcctacaatttggacacgaagaatgtgacaccaaccacgtgtcaatacacctaacatgaaacccgtgattacactttggcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27332711 |
ctcaacaagaagtgaattcctacaatttggacacgaagaatgtgacaccaaccacgtgtcaatacacctaacatgaaacccgtgattacactttggcaac |
27332612 |
T |
|
| Q |
101 |
attcgaactttgtcccctttctcaaactctcctaaacaaataggacactccgtcactggaatatcctctccggaaccaccgtacacagtcaccggaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27332611 |
attcgaactttgtcccctttctcaaactctcctaaacaaataggacactccgtcactggaatatcctctccggcaccaccgtacacagtcaccggaattt |
27332512 |
T |
|
| Q |
201 |
gactcagctcacgctttttcagacctgttttgtttagcctcaccgtggcttgttccggtgtctcttcggataatcttcggctgcaccgcatggcgcaacg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27332511 |
gactcagctcacgctttttcagacctgttttgtttagccttaccgtggcttgttccggtgtctcttcggataatcttcggctgcaccgcatggcgcaacg |
27332412 |
T |
|
| Q |
301 |
agctatggtgtttagccctagagcgcatatcaatgcacataatagtgctgctaatattatcaccatgtttgtgtcgaaattttcgacgttgatgaatgag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27332411 |
agctatggtgtttagccctagagcgcatatcaatgcacataatagtgctgctaatattatcaccatgtttgtgtcgaaattttcgacgttgatgaatgag |
27332312 |
T |
|
| Q |
401 |
tcgcttgtgttgttttcgtatgatg |
425 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27332311 |
tcgcttgtgttgttttcgtatgatg |
27332287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University