View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8132_high_16 (Length: 379)
Name: NF8132_high_16
Description: NF8132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8132_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 7950200 - 7949962
Alignment:
| Q |
1 |
taatggtgttttttcacatagatgctacatctattatgactacctactaccattaactgtgacttgataaagccacacaattattagcaacctcttcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7950200 |
taatggtgttttttcacatagatgctacatctattatgactacctactaccattaactgtgacttgataaagccacacaattattagcaacctcttcatc |
7950101 |
T |
|
| Q |
101 |
cattaaatggttagcttacttatgagttatgatttgtaattatgtgaaacaaaattgggctaaagaacgtgtagtctcaatctaaaattattggcttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7950100 |
cattaaatggttagcttacttatgagttatgatttgtaattatgtgaaacaagattgggctaaagaacgtgtagtctcaatctaaaattattggcttgtt |
7950001 |
T |
|
| Q |
201 |
tgtctttgaccatgtatgaaaaattttgtataattagaa |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7950000 |
tgtctttgaccatgtatgaaaaactttgtataattagaa |
7949962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 317 - 367
Target Start/End: Complemental strand, 7949734 - 7949684
Alignment:
| Q |
317 |
gttatttttagtctctgatgtcagcttaatgaatcacgcaaccgtaatttt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||| || ||||| |
|
|
| T |
7949734 |
gttatttttagtctctgatgtcagcttaataaatcacgtaactgtgatttt |
7949684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University