View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8132_high_17 (Length: 376)
Name: NF8132_high_17
Description: NF8132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8132_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 110 - 275
Target Start/End: Original strand, 48003325 - 48003490
Alignment:
| Q |
110 |
atctcatttgaaagtgtttacaatgctatgcagtttattctgctattaatttgcattattgtgtcacttaaacgatagaaaactggttaatggactacca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48003325 |
atctcatttgaaagtgtttacaatgctatgcagtttattctgctattaatttgcattattgtgtcacttaaacgatagaaaactggttaatggactacca |
48003424 |
T |
 |
| Q |
210 |
aatcttatggaaagtgtttcnnnnnnnnnnnnncttaaggagactgtagagctacatactgatagt |
275 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48003425 |
aatcttatggaaagtgtttcaaaaacaaaaaaacttaaggagactgtagagctacatactgatagt |
48003490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 48003214 - 48003260
Alignment:
| Q |
1 |
tctccctatctccctcac--tttgtatgattgaaaatgtgaaacttg |
45 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48003214 |
tctccctatctccctcacactttgtatgattgaaaatgtgaaacttg |
48003260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University